SeqAn3
seqan3::dot_bracket3 Class Reference

The three letter RNA structure alphabet of the characters ".()". More...

#include <seqan3/alphabet/structure/dot_bracket3.hpp>

Inheritance diagram for seqan3::dot_bracket3:
[legend]

Public Types

Member types
using char_type = char
 The type of the alphabet when converted to char (e.g. via to_char()).
 
using rank_type = detail::min_viable_uint_t< size - 1 >
 The type of the alphabet when represented as a number (e.g. via to_rank()).
 

Public Member Functions

Constructors, destructor and assignment
constexpr dot_bracket3 ()
 
constexpr dot_bracket3 (dot_bracket3 const &)=default
 
constexpr dot_bracket3 (dot_bracket3 &&)=default
 
constexpr dot_bracket3operator= (dot_bracket3 const &)=default
 
constexpr dot_bracket3operator= (dot_bracket3 &&)=default
 
 ~dot_bracket3 ()=default
 
Read functions
constexpr char_type to_char () const noexcept
 Return the letter as a character of char_type. More...
 
constexpr rank_type to_rank () const noexcept
 Return the letter's numeric value (rank in the alphabet). More...
 
Write functions
constexpr dot_bracket3assign_char (std::conditional_t< std::Same< char_type, void >, char, char_type > const c) noexcept
 Assign from a character. More...
 
constexpr dot_bracket3assign_rank (rank_type const c) noexcept
 Assign from a numeric value. More...
 

Static Public Attributes

static detail::min_viable_uint_t< size > constexpr value_size
 The size of the alphabet, i.e. the number of different values it can take.
 
Letter values

Static member "letters" that can be assigned to the alphabet or used in aggregate initialization.

Similar to an Enum interface. Don't worry about the internal_type.

static const dot_bracket3 UNPAIRED = dot_bracket3{}.assign_char('.')
 
static const dot_bracket3 PAIR_OPEN = dot_bracket3{}.assign_char('(')
 
static const dot_bracket3 PAIR_CLOSE = dot_bracket3{}.assign_char(')')
 
static const dot_bracket3 UNKNOWN = dot_bracket3::UNPAIRED
 

Related Functions

(Note that these are not member functions.)

std::vector< dot_bracket3operator""_db3 (const char *str, std::size_t len)
 dot_bracket3 literal More...
 
std::optional< uint8_t > pseudoknot_id (structure_type const alph)
 Get an identifier for a pseudoknotted interaction. More...
 
Requirements for seqan3::rna_structure_concept

You can expect these functions on all types that implement seqan3::rna_structure_concept.

template<typename alphabet_type >
constexpr uint8_t max_pseudoknot_depth_v = max_pseudoknot_depth<alphabet_type>::value
 The pseudoknot ability of the alphabet. [value metafunction shortcut]. More...
 
Helpers for seqan3::rna_structure_concept

These functions and metafunctions expose member variables and types so that they satisfy seqan3::rna_structure_concept.

template<typename structure_type >
constexpr bool is_pair_open (structure_type const alph) requires requires(structure_type alph)
 Implementation of seqan3::rna_structure_concept::is_pair_open() that delegates to a member function. More...
 
template<typename structure_type >
constexpr bool is_pair_close (structure_type const alph) requires requires(structure_type alph)
 Implementation of seqan3::rna_structure_concept::is_pair_close() that delegates to a member function. More...
 
template<typename structure_type >
constexpr bool is_unpaired (structure_type const alph) requires requires(structure_type alph)
 Implementation of seqan3::rna_structure_concept::is_unpaired() that delegates to a member function. More...
 
template<typename alphabet_type_with_pseudoknot_attribute >
constexpr std::optional< uint8_t > pseudoknot_id (alphabet_type_with_pseudoknot_attribute const alph)
 Implementation of seqan3::rna_structure_concept::pseudoknot_id() that delegates to a member function. More...
 
Requirements for seqan3::alphabet_concept

You can expect these functions on all types that implement seqan3::alphabet_concept.

template<typename alphabet_type >
using underlying_char_t = typename underlying_char< alphabet_type >::type
 The char_type of the alphabet. [type metafunction shortcut]. More...
 
char_type to_char (alphabet_concept const alph)
 Returns the alphabet letter's value in character representation. More...
 
alphabet_concept && assign_char (alphabet_concept &&alph, char_type const chr)
 Returns the alphabet letter's value in character representation. More...
 
Requirements for seqan3::semi_alphabet_concept

You can expect these functions on all types that implement seqan3::semi_alphabet_concept.

template<typename semi_alphabet_type >
using underlying_rank_t = typename underlying_rank< semi_alphabet_type >::type
 The rank_type of the semi_alphabet. [type metafunction shortcut]. More...
 
template<typename alphabet_type >
constexpr auto alphabet_size_v = alphabet_size<alphabet_type>::value
 The size of the alphabet. [value metafunction shortcut]. More...
 
rank_type to_rank (semi_alphabet_concept const alph)
 Returns the alphabet letter's value in rank representation. More...
 
semi_alphabet_concept && assign_rank (semi_alphabet_concept &&alph, rank_type const rank)
 Returns the alphabet letter's value in rank representation. More...
 
Requirements for std::Swappable

You can expect these functions on all types that implement std::Swappable.

void swap (t &lhs, t &rhs)
 Swaps the contents of two objects. More...
 
Requirements for std::EqualityComparable

You can expect these functions on all types that implement std::Equality_comparable.

bool operator== (type const &lhs, type const &rhs)
 (In-)Equality comparison. More...
 
bool operator!= (type const &lhs, type const &rhs)
 (In-)Equality comparison. More...
 
Requirements for std::StrictTotallyOrdered

You can expect these functions on all types that implement std::StrictTotallyOrdered.

bool operator< (type const &lhs, type const &rhs)
 Less-than, greater-than and -or-equal comparisons. More...
 
bool operator<= (type const &lhs, type const &rhs)
 Less-than, greater-than and -or-equal comparisons. More...
 
bool operator> (type const &lhs, type const &rhs)
 Less-than, greater-than and -or-equal comparisons. More...
 
bool operator>= (type const &lhs, type const &rhs)
 Less-than, greater-than and -or-equal comparisons. More...
 

RNA structure properties

static constexpr uint8_t max_pseudoknot_depth {1}
 The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth. More...
 
constexpr bool is_pair_open () const noexcept
 Check whether the character represents a rightward interaction in an RNA structure. More...
 
constexpr bool is_pair_close () const noexcept
 Check whether the character represents a leftward interaction in an RNA structure. More...
 
constexpr bool is_unpaired () const noexcept
 Check whether the character represents an unpaired position in an RNA structure. More...
 

Detailed Description

The three letter RNA structure alphabet of the characters ".()".

The brackets denote RNA base pair interactions. Every left bracket must have a corresponding right bracket. Pseudoknots cannot be expressed in this format. A dot (.) represents a character that is not paired.

GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUUUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCA
(((((((..((((........)))).((((.........)))).....(((((.......)))))))))))).
Usage
The following code example creates a dot_bracket3 vector, modifies it, and prints the result to stdout.
// create vector
std::vector<dot_bracket3> vec{dot_bracket3::UNPAIRED, dot_bracket3::PAIR_CLOSE, dot_bracket3::PAIR_CLOSE};
// modify and print
vec[1] = dot_bracket3::PAIR_OPEN;
for (dot_bracket3 chr : vec)
debug_stream << to_char(chr); // .()
debug_stream << "\n";

Member Function Documentation

◆ assign_char()

constexpr dot_bracket3 & seqan3::alphabet_base< dot_bracket3 , size, char >::assign_char ( std::conditional_t< std::Same< char_type, void >, char, char_type > const  c)
inlinenoexceptinherited

Assign from a character.

Satisfies the seqan3::alphabet_concept::assign_char() requirement via the seqan3::assign_char() wrapper.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

◆ assign_rank()

constexpr dot_bracket3 & seqan3::alphabet_base< dot_bracket3 , size, char >::assign_rank ( rank_type const  c)
inlinenoexceptinherited

Assign from a numeric value.

Satisfies the seqan3::semi_alphabet_concept::assign_rank() requirement via the seqan3::assign_rank() wrapper.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

◆ is_pair_close()

constexpr bool seqan3::dot_bracket3::is_pair_close ( ) const
inlinenoexcept

Check whether the character represents a leftward interaction in an RNA structure.

Returns
True if the letter represents a leftward interaction, False otherwise.

◆ is_pair_open()

constexpr bool seqan3::dot_bracket3::is_pair_open ( ) const
inlinenoexcept

Check whether the character represents a rightward interaction in an RNA structure.

Returns
True if the letter represents a rightward interaction, False otherwise.

◆ is_unpaired()

constexpr bool seqan3::dot_bracket3::is_unpaired ( ) const
inlinenoexcept

Check whether the character represents an unpaired position in an RNA structure.

Returns
True if the letter represents an unpaired site, False otherwise.

◆ to_char()

constexpr char_type seqan3::alphabet_base< dot_bracket3 , size, char >::to_char ( ) const
inlinenoexceptinherited

Return the letter as a character of char_type.

Satisfies the seqan3::alphabet_concept::to_char() requirement via the seqan3::to_char() wrapper.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

◆ to_rank()

constexpr rank_type seqan3::alphabet_base< dot_bracket3 , size, char >::to_rank ( ) const
inlinenoexceptinherited

Return the letter's numeric value (rank in the alphabet).

Satisfies the seqan3::semi_alphabet_concept::to_rank() requirement via the to_rank() wrapper.

Complexity

Constant.

Exceptions

Guaranteed not to throw.

Friends And Related Function Documentation

◆ is_pair_close()

template<typename structure_type >
constexpr bool is_pair_close ( structure_type const  alph)
related

Implementation of seqan3::rna_structure_concept::is_pair_close() that delegates to a member function.

Template Parameters
structure_typeMust provide a .is_pair_close() member function.
Parameters
alphThe alphabet letter which is checked for the pairing property.
Returns
True if the letter represents a leftward interaction, False otherwise.

◆ is_pair_open()

template<typename structure_type >
constexpr bool is_pair_open ( structure_type const  alph)
related

Implementation of seqan3::rna_structure_concept::is_pair_open() that delegates to a member function.

Template Parameters
structure_typeMust provide a .is_pair_open() member function.
Parameters
alphThe alphabet letter which is checked for the pairing property.
Returns
True if the letter represents a rightward interaction, False otherwise.

◆ is_unpaired()

template<typename structure_type >
constexpr bool is_unpaired ( structure_type const  alph)
related

Implementation of seqan3::rna_structure_concept::is_unpaired() that delegates to a member function.

Template Parameters
structure_typeMust provide a .is_unpaired() member function.
Parameters
alphThe alphabet letter which is checked for the pairing property.
Returns
True if the letter represents an unpaired site, False otherwise.

◆ operator""_db3()

std::vector< dot_bracket3 > operator""_db3 ( const char *  str,
std::size_t  len 
)
related

dot_bracket3 literal

Returns
std::vector<seqan3::dot_bracket3>

You can use this string literal to easily assign to a vector of dot_bracket3 characters:

std::vector<dot_bracket3> foo{".(..)."_db3};
std::vector<dot_bracket3> bar = ".(..)."_db3;
auto bax = ".(..)."_db3;

◆ pseudoknot_id() [1/2]

std::optional< uint8_t > pseudoknot_id ( structure_type const  alph)
related

Get an identifier for a pseudoknotted interaction.

Parameters
alphThe alphabet letter which is checked for the pseudoknot id.
Returns
The pseudoknot id, if alph represents an interaction, and no value otherwise. It is guaranteed to be smaller than seqan3::max_pseudoknot_depth.

◆ pseudoknot_id() [2/2]

template<typename alphabet_type_with_pseudoknot_attribute >
constexpr std::optional< uint8_t > pseudoknot_id ( alphabet_type_with_pseudoknot_attribute const  alph)
related

Implementation of seqan3::rna_structure_concept::pseudoknot_id() that delegates to a member function.

Template Parameters
alphabet_type_with_pseudoknot_attributeIf it supports pseudoknots, it must provide a .pseudoknot_id() member function, otherwise it can be omitted.
Parameters
alphThe alphabet letter which is checked for the pseudoknot id.
Returns
The pseudoknot id, if alph represents an interaction, and no value otherwise. It is guaranteed to be smaller than seqan3::max_pseudoknot_depth.

Member Data Documentation

◆ max_pseudoknot_depth

constexpr uint8_t seqan3::dot_bracket3::max_pseudoknot_depth {1}
static

The ability of this alphabet to represent pseudoknots, i.e. crossing interactions, up to a certain depth.

It is the number of distinct pairs of interaction symbols the format supports. The value 1 denotes no pseudoknot support.


The documentation for this class was generated from the following file: